| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-04-03 05:25:24 |
| Analysis completed | 2025-04-03 05:25:24 |
| Wall time | 0:0:0 hours |
| locus | COI |
| preliminary_id | Aphididae |
| taxa_of_interest |
Aphidius ervi Aphididae |
| country | Kenya |
| host | Cut flower Rosa |
| sample_id | VE24-1068_COI |
| Query DNA sequence |
>VE24-1068_COI AACTTTATATTTTTTATTTGGTATTTGATCAGGTATAATTGGATCATCACTTAGAATTTT AATTCGTCTTGAATTAAGACAAATTAATTCAATTATTAATAATAATCAATTATATAATGT TATTGTTACAATCCATGCTTTTATTATAATTTTTTTTATAACAATACCAATTGTAATTGG TGGATTTGGAAATTGATTAATTCCTATAATAATAGGATGCCCTGATATATCATTTCCACG TTTAAATAACATTAGATTTTGATTATTACCACCTTCATTAATAATAATAATTTGTAGTTT TTTAATTAATAATGGAACAGGAACAGGATGAACTATTTATCCACCTTTATCAAATAATAT TGCACATAATAATATCTCAGTTGATTTAACTATCTTTTCTTTACATTTAGCAGGAATTTC ATCAATTTTAGGAGCAATTAATTTTATTTGTACAATTTTAAATATAATACCAAATAATAT AAAACTTAATCAAATTCCTCTTTTCCCTTGATCAATTTTAATTACAGCCATTTTATTAAT TTTATCTTTACCAGTACTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATTTAAA TACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Inconclusive
The analyst should attempt subjective species identification at the genus level.
Reasoning - Flag 1C:
>3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed | NA |
|
Inconclusive taxonomic identity (Flag 1C) |
|
| Taxa of interest ruled out | False |
|
Flag 2B: Taxon of interest detected Flag 5.1NA: Assessment of related species is only possible for taxa at rank genus/species Flag 5.2NA: Assessment of related species is only possible for taxa at rank genus/species |
|
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits are then classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 33 | 7 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
Hits per candidate species (top 10 candidates only)
| Species | Hits | Identity | E-value |
|---|---|---|---|
| Wahlgreniella nervata | 7 | 100.0% | 0.0 |
| Aphidinae sp. BOLD-2016 | 7 | 100.0% | 0.0 |
| Rhodobium porosum | 10 | 100.0% | 0.0 |
| Ericaphis scammelli | 2 | 99.4% | 0.0 |
| Ericaphis fimbriata | 5 | 98.8% | 0.0 |
| Ericaphis sp. RFBAE098-09 | 1 | 98.5% | 0.0 |
| Wahlgreniella sp. BOLD:AAB6874 | 1 | 98.5% | 0.0 |
| # | Accession | Hit subject | Align length | Query coverage | Score | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | KF285590 | Wahlgreniella nervata voucher ORP SP-LK1 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 658.0 | 0.00e+00 | 100.0% |
| 2 | KR918182 | Aphidinae sp. BOLD-2016 voucher BIOUG19490-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 609 | 92.6% | 609.0 | 0.00e+00 | 100.0% |
| 3 | KR035607 | Rhodobium porosum voucher CNC#HEM059754 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 588 | 89.4% | 588.0 | 0.00e+00 | 100.0% |
| 4 | KR917707 | Aphidinae sp. BOLD-2016 voucher BIOUG19490-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 88.4% | 582.0 | 0.00e+00 | 100.0% |
| 5 | KR917324 | Aphidinae sp. BOLD-2016 voucher BIOUG19490-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 88.4% | 582.0 | 0.00e+00 | 100.0% |
| 6 | KR917443 | Aphidinae sp. BOLD-2016 voucher BIOUG19490-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 88.0% | 579.0 | 0.00e+00 | 100.0% |
| 7 | KR917983 | Aphidinae sp. BOLD-2016 voucher BIOUG18858-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 564 | 85.7% | 564.0 | 0.00e+00 | 100.0% |
| 8 | MH820769 | Rhodobium porosum voucher HL668 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 560.0 | 0.00e+00 | 100.0% |
| 9 | KY831459 | Rhodobium porosum voucher BIOUG02439-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 10 | JX844363 | Rhodobium porosum voucher ZMIOZ 14236 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 11 | MN319889 | Rhodobium porosum voucher CCDB-23161-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 12 | KY837014 | Rhodobium porosum voucher BIOUG02439-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 13 | KY832088 | Rhodobium porosum voucher BIOUG02527-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 14 | MH820770 | Rhodobium porosum voucher HLZ225 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 15 | MH820771 | Rhodobium porosum voucher HLZ229 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 16 | EU701647 | Ericaphis scammelli voucher CNC#HEM055876 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 17 | MZ091382 | Rhodobium porosum voucher Rhodobium-porosum-KSA-Taif cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 618 | 93.9% | 606.0 | 0.00e+00 | 99.4% |
| 18 | EU701648 | Ericaphis scammelli voucher CNC#HEM113518 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 642.0 | 0.00e+00 | 99.2% |
| 19 | EU701642 | Ericaphis fimbriata voucher CNC#HEM051670 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 634.0 | 0.00e+00 | 98.8% |
| 20 | KR032227 | Wahlgreniella nervata voucher CHAN-2006-0309 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 599 | 91.0% | 575.0 | 0.00e+00 | 98.7% |
| 21 | EU701959 | Wahlgreniella nervata voucher CNC#HEM054223 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 632.0 | 0.00e+00 | 98.6% |
| 22 | EU701639 | Ericaphis fimbriata voucher CNC#HEM055945 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 631.0 | 0.00e+00 | 98.6% |
| 23 | EU701958 | Wahlgreniella nervata voucher CNC#HEM054195 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 630.0 | 0.00e+00 | 98.6% |
| 24 | KR032015 | Wahlgreniella nervata voucher CNC#HEM057594 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 625 | 95.0% | 598.0 | 0.00e+00 | 98.6% |
| 25 | KR038132 | Ericaphis fimbriata voucher CNC#HEM056382 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 628.0 | 0.00e+00 | 98.5% |
| 26 | KR035217 | Ericaphis fimbriata voucher CNC#HEM051816 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 628.0 | 0.00e+00 | 98.5% |
| 27 | GU667405 | Ericaphis sp. RFBAE098-09 voucher CNC#HEM063302 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 628.0 | 0.00e+00 | 98.5% |
| 28 | KC502857 | Wahlgreniella nervata voucher CCDB-08107-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 627.0 | 0.00e+00 | 98.5% |
| 29 | EU701643 | Ericaphis fimbriata voucher CNC#HEM051750 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 627.0 | 0.00e+00 | 98.5% |
| 30 | KC502856 | Wahlgreniella sp. BOLD:AAB6874 voucher CCDB-08110-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 627.0 | 0.00e+00 | 98.5% |
| 31 | KR034136 | Wahlgreniella nervata voucher CHAN-2006-0310 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 627.0 | 0.00e+00 | 98.5% |
| 32 | KR584489 | Aphidinae sp. BOLD-2016 voucher BIOUG16130-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 609 | 92.6% | 584.0 | 0.00e+00 | 98.5% |
| 33 | KR583178 | Aphidinae sp. BOLD-2016 voucher BIOUG06659-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 88.4% | 555.0 | 0.00e+00 | 98.5% |
| 34 | KR562610 | Aphidinae sp. BOLD-2016 voucher BIOUG03971-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 93.2% | 583.0 | 0.00e+00 | 98.4% |
| 35 | MG165014 | Aphidinae sp. BIOUG28272-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 88.0% | 552.0 | 0.00e+00 | 98.4% |
| 36 | KR034584 | Wahlgreniella nervata voucher 10BBCHEM-0569 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 626.0 | 0.00e+00 | 98.3% |
| 37 | KC502858 | Wahlgreniella nervata voucher CCDB-08107-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 625.0 | 0.00e+00 | 98.3% |
| 38 | EU701641 | Ericaphis fimbriata voucher CNC#HEM113032 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 625.0 | 0.00e+00 | 98.3% |
| 39 | KR033524 | Wahlgreniella vaccinii voucher CNC#HEM057248 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 624.0 | 0.00e+00 | 98.3% |
| 40 | HQ970872 | Wahlgreniella vaccinii voucher CNC#HEM070052 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 624.0 | 0.00e+00 | 98.3% |
| 41 | EU701956 | Wahlgreniella nervata voucher CNC#HEM029006 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 637 | 96.8% | 604.0 | 0.00e+00 | 98.3% |
| 42 | KR343902 | Aphidinae sp. BOLD:AAB6874 voucher BIOUG11575-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 583 | 88.6% | 553.0 | 0.00e+00 | 98.3% |
| 43 | KR346870 | Aphidinae sp. BOLD:AAB6874 voucher BIOUG14089-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 88.4% | 552.0 | 0.00e+00 | 98.3% |
| 44 | KR341125 | Aphidinae sp. BOLD:AAB6874 voucher BIOUG14089-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 88.4% | 552.0 | 0.00e+00 | 98.3% |
| 45 | KR340942 | Aphidinae sp. BOLD:AAB6874 voucher BIOUG14089-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 88.0% | 551.0 | 0.00e+00 | 98.3% |
| 46 | KR346888 | Aphidinae sp. BOLD:AAB6874 voucher BIOUG12701-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 88.0% | 550.0 | 0.00e+00 | 98.3% |
| 47 | KU567959 | Wahlgreniella vaccinii voucher BIOUG07985-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 88.0% | 550.0 | 0.00e+00 | 98.3% |
| 48 | EU701957 | Wahlgreniella nervata voucher CNC#HEM054153 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 622.0 | 0.00e+00 | 98.2% |
| 49 | KR346853 | Aphidinae sp. BOLD:AAB6874 voucher BIOUG11575-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 93.3% | 583.0 | 0.00e+00 | 98.2% |
| 50 | KR341194 | Aphidinae sp. BOLD:AAB6874 voucher BIOUG11575-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 611 | 92.9% | 583.0 | 0.00e+00 | 98.2% |
| 51 | MF836214 | Aphidinae sp. BIOUG27154-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 93.0% | 579.0 | 0.00e+00 | 98.2% |
| 52 | KR342698 | Aphidinae sp. BOLD:AAB6874 voucher BIOUG14089-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 91.6% | 572.0 | 0.00e+00 | 98.2% |
| 53 | MF832468 | Aphidinae sp. BIOUG26722-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 594 | 90.3% | 561.0 | 0.00e+00 | 98.1% |
| 54 | KU567897 | Wahlgreniella vaccinii voucher BIOUG07985-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 591 | 89.8% | 558.0 | 0.00e+00 | 98.1% |
| 55 | KU567860 | Wahlgreniella vaccinii voucher BIOUG07986-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 88.4% | 550.0 | 0.00e+00 | 98.1% |
| 56 | KR342491 | Aphidinae sp. BOLD:AAB6874 voucher BIOUG14089-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 88.4% | 549.0 | 0.00e+00 | 98.1% |
| 57 | KR042323 | Wahlgreniella vaccinii voucher CNC#HEM057428 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 620.0 | 0.00e+00 | 98.0% |
| 58 | JF883918 | Wahlgreniella sp. RDBAB1591-10 voucher CNC#HEM071510 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 615.0 | 0.00e+00 | 97.9% |
| 59 | KR346548 | Aphidinae sp. BOLD:AAB6874 voucher BIOUG11575-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 91.6% | 568.0 | 0.00e+00 | 97.8% |
| 60 | KR344292 | Aphidinae sp. BOLD:AAB6874 voucher BIOUG11575-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 91.5% | 568.0 | 0.00e+00 | 97.8% |
| 61 | KU567724 | Wahlgreniella vaccinii voucher BIOUG07983-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 591 | 89.8% | 556.0 | 0.00e+00 | 97.8% |
| 62 | KU567800 | Wahlgreniella sp. BIOUG07983-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 611 | 92.9% | 570.0 | 0.00e+00 | 97.5% |
| 63 | KR574695 | Aphidinae sp. BOLD-2016 voucher BIOUG05961-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 96.2% | 583.0 | 0.00e+00 | 97.3% |
| 64 | KR582010 | Rhodobium sp. BOLD-2016 voucher 10BBCHEM-0130 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 600.0 | 0.00e+00 | 97.0% |
| 65 | EU701651 | Ericaphis wakibae voucher CNC#HEM054347 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 589.0 | 0.00e+00 | 96.5% |
| 66 | KR031800 | Ericaphis wakibae voucher CHAN-2006-0446.2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 588.0 | 0.00e+00 | 96.5% |
| 67 | KR574256 | Aphidinae sp. BOLD-2016 voucher BIOUG03938-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 566.0 | 0.00e+00 | 96.5% |
| 68 | KR569371 | Aphidinae sp. BOLD-2016 voucher BIOUG03941-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 566.0 | 0.00e+00 | 96.5% |
| 69 | EU701519 | Macrosiphum dorsatum voucher CNC#HEM113993.1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 586.0 | 0.00e+00 | 96.4% |
| 70 | KR570337 | Aphidinae sp. BOLD-2016 voucher BIOUG03938-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 96.0% | 563.0 | 0.00e+00 | 96.4% |
| 71 | EU701646 | Ericaphis lilii voucher CNC#HEM051740 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 585.0 | 0.00e+00 | 96.3% |
| 72 | KR031830 | Ericaphis wakibae voucher CHAN-2006-0447.2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 585.0 | 0.00e+00 | 96.3% |
| 73 | EU701657 | Ericaphis wakibae voucher CNC#HEM051762 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 585.0 | 0.00e+00 | 96.3% |
| 74 | EU701656 | Ericaphis wakibae voucher CNC#HEM054345 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 584.0 | 0.00e+00 | 96.3% |
| 75 | KR569518 | Aphidinae sp. BOLD-2016 voucher BIOUG03160-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 95.7% | 561.0 | 0.00e+00 | 96.3% |
| 76 | JF883830 | Ericaphis wakibae voucher CNC#HEM070684 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 583.0 | 0.00e+00 | 96.2% |
| 77 | KR030913 | Illinoia rubicola voucher 10BBCHEM-0193 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 637 | 96.8% | 562.0 | 0.00e+00 | 96.1% |
| 78 | EU701522 | Aulacorthum pterinigrum voucher CNC#HEM054304 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 580.0 | 0.00e+00 | 96.0% |
| 79 | KR040012 | Cryptomyzus galeopsidis voucher BIOUG00806-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 580.0 | 0.00e+00 | 96.0% |
| 80 | HQ970634 | Cryptomyzus galeopsidis voucher CNC#HEM070087 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 580.0 | 0.00e+00 | 96.0% |
| 81 | EU701524 | Aulacorthum pterinigrum voucher CNC#HEM054308 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 579.0 | 0.00e+00 | 96.0% |
| 82 | KR043475 | Nasonovia houghtonensis similis voucher CNC#HEM057392 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 577.0 | 0.00e+00 | 95.9% |
| 83 | KR040915 | Nasonovia castelleiae voucher CNC#HEM051379 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 576.0 | 0.00e+00 | 95.9% |
| 84 | MN678970 | Nasonovia sp. BOLD:ADT3939 voucher CHARS00086-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 653 | 99.2% | 572.0 | 0.00e+00 | 95.9% |
| 85 | MN679843 | Nasonovia sp. BOLD:ADT3939 voucher CHARS00086-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 99.1% | 571.0 | 0.00e+00 | 95.9% |
| 86 | MN672266 | Nasonovia sp. BOLD:ADT3939 voucher CHARS00086-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 99.1% | 571.0 | 0.00e+00 | 95.9% |
| 87 | MN670047 | Nasonovia sp. BOLD:ADT3939 voucher CHARS00086-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 641 | 97.4% | 560.0 | 0.00e+00 | 95.8% |
| 88 | KR038153 | Uroleucon impatiensicolens voucher CNC#HEM006418 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 574.0 | 0.00e+00 | 95.7% |
| 89 | KF639737 | Uroleucon sp. INRA CBGP ACOE614/chasses614-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 574.0 | 0.00e+00 | 95.7% |
| 90 | KR040149 | Nasonovia houghtonensis voucher CNC#HEM070295 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 574.0 | 0.00e+00 | 95.7% |
| 91 | KR043756 | Uroleucon impatiensicolens voucher CNC#HEM055797 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 574.0 | 0.00e+00 | 95.7% |
| 92 | EU701810 | Nasonovia cynosbati voucher CNC#HEM032870 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 573.0 | 0.00e+00 | 95.7% |
| 93 | GU668703 | Nasonovia castelleiae voucher CNC#HEM063684 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 573.0 | 0.00e+00 | 95.7% |
| 94 | EU701808 | Nasonovia aquilegiae voucher CNC#HEM032961 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 573.0 | 0.00e+00 | 95.7% |
| 95 | MN665397 | Nasonovia sp. BOLD:ADT3939 voucher CHARS00075-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 98.9% | 567.0 | 0.00e+00 | 95.7% |
| 96 | KR031513 | Aulacorthum solani voucher CNC#HEM054346 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 572.0 | 0.00e+00 | 95.6% |
| 97 | PQ096067 | Uroleucon sp. mitochondrion, complete genome | 658 | 100.0% | 571.0 | 0.00e+00 | 95.6% |
| 98 | HM405541 | Hyperomyzus pallidus voucher CGAEC-066 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 571.0 | 0.00e+00 | 95.6% |
| 99 | HQ578885 | Aulacorthum solani voucher CNC#HEM049282 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 571.0 | 0.00e+00 | 95.6% |
| 100 | KR031540 | Macrosiphum gaurae voucher CNC#HEM061500 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 571.0 | 0.00e+00 | 95.6% |
| 101 | KF639118 | Aulacorthum solani voucher INRA CBGP ACOE1349/chasses1349-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 571.0 | 0.00e+00 | 95.6% |
| 102 | KR034655 | Aulacorthum solani voucher CNC#HEM113997 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 571.0 | 0.00e+00 | 95.6% |
| 103 | KF639647 | Staticobium sp. INRA CBGP ACOE1519/chasses1519-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 571.0 | 0.00e+00 | 95.6% |
| 104 | KR043459 | Illinoia rubicola voucher BIOUG02608-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 570.0 | 0.00e+00 | 95.6% |
| 105 | KR034857 | Nasonovia castelleiae voucher BIOUG02022-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 570.0 | 0.00e+00 | 95.6% |
| 106 | MN681412 | Nasonovia sp. BOLD:ADT3939 voucher CHARS00075-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 641 | 97.4% | 557.0 | 0.00e+00 | 95.6% |
| 107 | OR287722 | Insecta sp. isolate SHARAWI_8 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 609 | 92.6% | 554.0 | 0.00e+00 | 95.6% |
| 108 | EU701809 | Nasonovia aquilegiae voucher CNC#HEM028922 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 636 | 96.7% | 552.0 | 0.00e+00 | 95.6% |
| 109 | KR036532 | Illinoia rubicola voucher BIOUG07501-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 635 | 96.5% | 551.0 | 0.00e+00 | 95.6% |
| 110 | KR044282 | Illinoia rubicola voucher BIOUG07501-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 635 | 96.5% | 551.0 | 0.00e+00 | 95.6% |
| 111 | KR040799 | Nasonovia castelleiae voucher BIOUG02022-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 98.8% | 563.0 | 0.00e+00 | 95.5% |
| 112 | OP066221 | Metopolophium dirhodum voucher Metopolophium_dirhodum cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 644 | 97.9% | 557.0 | 0.00e+00 | 95.5% |
| 113 | KR037917 | Illinoia rubicola voucher CNC#HEM039722 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 643 | 97.7% | 556.0 | 0.00e+00 | 95.5% |
| 114 | MN683201 | Nasonovia sp. BOLD:ADT3939 voucher CHARS00075-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 640 | 97.3% | 553.0 | 0.00e+00 | 95.5% |
| 115 | KR042366 | Nasonovia castelleiae voucher CNC#HEM057329 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 97.1% | 552.0 | 0.00e+00 | 95.5% |
| 116 | MW315412 | Uroleucon nigrotibium voucher A06 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 639 | 97.1% | 552.0 | 0.00e+00 | 95.5% |
| 117 | KR042019 | Aulacorthum solani voucher CNC#HEM062451 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 569.0 | 0.00e+00 | 95.4% |
| 118 | KR031269 | Aulacorthum solani voucher CNC#HEM114034 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 569.0 | 0.00e+00 | 95.4% |
| 119 | EU701814 | Nasonovia takala voucher CNC#HEM028699 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 120 | EU701949 | Uroleucon nigrotibium voucher CNC#HEM056154 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 121 | GU559861 | Uroleucon luteolum voucher UKY JH-372 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 122 | MW315439 | Uroleucon nigrotibium voucher A35 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 123 | MW315440 | Uroleucon nigrotibium voucher A36 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 124 | KF639707 | Uroleucon jaceae voucher INRA CBGP ACOE1383/chasses1383-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 125 | KU374293 | Acyrthosiphon sp. 1 HKW-2016 voucher ZA2011-30329 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 126 | EU701286 | Amphorophora agathonica voucher CNC#HEM012053 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 127 | KR036845 | Aulacorthum solani voucher CNC#HEM061872 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 128 | KR565960 | Uroleucon (Uroleucon) sp. BOLD-2016 voucher BIOUG01504-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 129 | KF639123 | Aulacorthum solani voucher INRA CBGP ACOE605/chasses605-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 130 | KR043141 | Illinoia rubicola voucher 10BBCHEM-0535 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 131 | EU701525 | Aulacorthum solani voucher CNC#HEM055900 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 132 | KF638728 | Amphorophora rubi voucher INRA CBGP ACOE1136/chasses1136-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 133 | MK814189 | Aulacorthum solani cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 134 | GU668145 | Uroleucon sp. RFBAE030-09 voucher CNC#HEM062575 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 135 | JF969253 | Aulacorthum solani cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 136 | EU301802 | Aulacorthum solani isolate 3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 568.0 | 0.00e+00 | 95.4% |
| 137 | KR042209 | Nasonovia castelleiae voucher BIOUG02022-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 567.0 | 0.00e+00 | 95.4% |
| 138 | EU701794 | Myzus ornatus voucher CNC#HEM054042 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 567.0 | 0.00e+00 | 95.4% |
| 139 | KR031009 | Nasonovia castelleiae voucher CNC#HEM057192 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 567.0 | 0.00e+00 | 95.4% |
| 140 | GU668122 | Illinoia rubicola voucher CNC#HEM062602 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 567.0 | 0.00e+00 | 95.4% |
| 141 | GU978797 | Eumyzus impatiensae isolate 030925J04 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 657 | 99.8% | 567.0 | 0.00e+00 | 95.4% |
| 142 | KR042428 | Nasonovia castelleiae voucher BIOUG02037-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 567.0 | 0.00e+00 | 95.4% |
| 143 | KR033530 | Nasonovia cynosbati voucher BIOUG01643-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 567.0 | 0.00e+00 | 95.4% |
| 144 | KR030718 | Illinoia rubicola voucher BIOUG02608-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 567.0 | 0.00e+00 | 95.4% |
| 145 | KR035649 | Amphorophora agathonica voucher CNC#HEM055856 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 567.0 | 0.00e+00 | 95.4% |
| 146 | EU701806 | Nasonovia alpina voucher CNC#HEM055862 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 567.0 | 0.00e+00 | 95.4% |
| 147 | HQ970874 | Nasonovia cynosbati voucher CNC#HEM070054 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 567.0 | 0.00e+00 | 95.4% |
| 148 | GU668163 | Illinoia rubicola voucher CNC#HEM062583 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 566.0 | 0.00e+00 | 95.4% |
| 149 | KR035055 | Illinoia rubicola voucher CNC#HEM056874 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 566.0 | 0.00e+00 | 95.4% |
| 150 | HM416715 | Amphorophora agathonica voucher CNC#HEM064258 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 655 | 99.5% | 565.0 | 0.00e+00 | 95.4% |
| 151 | KY606277 | Aulacorthum solani isolate Sml_A61 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 559.0 | 0.00e+00 | 95.4% |
| 152 | KY606278 | Aulacorthum solani isolate Jalandhar_A3 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 559.0 | 0.00e+00 | 95.4% |
| 153 | KY606275 | Aulacorthum solani isolate Modipuram_CA4 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 559.0 | 0.00e+00 | 95.4% |
| 154 | GU978924 | Aulacorthum solani isolate 060407S141 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 648 | 98.5% | 558.0 | 0.00e+00 | 95.4% |
| 155 | KR039727 | Illinoia rubicola voucher BIOUG07501-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 637 | 96.8% | 550.0 | 0.00e+00 | 95.4% |
| 156 | JF883695 | Nasonovia castelleiae voucher CNC#HEM070649 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 636 | 96.7% | 549.0 | 0.00e+00 | 95.4% |
| 157 | KR043957 | Illinoia rubicola voucher BIOUG07501-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 636 | 96.7% | 549.0 | 0.00e+00 | 95.4% |
| 158 | KR040011 | Nasonovia castelleiae voucher BIOUG02022-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 566.0 | 0.00e+00 | 95.3% |
| 159 | KR032947 | Phorodon humuli voucher CNC#HEM114055 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 160 | JX507423 | Macrosiphum ptericolens voucher A18 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 161 | OP103698 | Phorodon humuli isolate 53 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 162 | OP103694 | Phorodon humuli isolate 44 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 163 | OP103695 | Phorodon humuli isolate 46 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 164 | GU978961 | Aulacorthum ibotum isolate 030605S04 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 165 | KR034445 | Uroleucon russellae voucher CNC#HEM114015 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 166 | JX507416 | Amphorophora rubi voucher A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 167 | EU701948 | Uroleucon nigrotibium voucher CNC#HEM055860 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 168 | KF639712 | Uroleucon jaceae voucher INRA CBGP ACOE574/chasses574-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 169 | KR039323 | Aulacorthum solani voucher CNC#HEM061902 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 170 | HQ971305 | Macrosiphum valerianae voucher CNC#HEM068396 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 171 | KR031170 | Hyperomyzus sandilandicus voucher CNC#HEM059484 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 172 | OP103697 | Phorodon humuli isolate 52 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 173 | PV016929 | Uroleucon nigrotuberculatum isolate A122 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 174 | KF638727 | Amphorophora rubi voucher INRA CBGP ACOE1036/chasses1036-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 175 | GU668533 | Uroleucon sp. RFBAE654-09 voucher CNC#HEM063636 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 176 | KR037807 | Macrosiphum osmaroniae voucher CNC#HEM061895 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 177 | OP103696 | Phorodon humuli isolate 50 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 178 | KR035728 | Aulacorthum solani voucher CNC#HEM071278 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 179 | MF834209 | Amphorophora agathonica voucher BIOUG22206-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 180 | HQ970878 | Hyperomyzus sandilandicus voucher CNC#HEM070061 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 181 | OP103700 | Phorodon humuli isolate 42 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 182 | OP103699 | Phorodon humuli isolate 47 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 183 | KR567827 | Uroleucon sp. BOLD-2016 voucher BIOUG02022-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 565.0 | 0.00e+00 | 95.3% |
| 184 | EU701951 | Uroleucon nigrotibium voucher CNC#HEM012146 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 564.0 | 0.00e+00 | 95.3% |
| 185 | DQ499029 | Aulacorthum solani isolate 1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 564.0 | 0.00e+00 | 95.3% |
| 186 | OP164556 | Sitobion avenae isolate Aphid7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 564.0 | 0.00e+00 | 95.3% |
| 187 | OP174286 | Macrosiphum euphorbiae isolate AphidRose7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 564.0 | 0.00e+00 | 95.3% |
| 188 | KF639517 | Megoura viciae voucher INRA CBGP ACOE2131/chasses2131-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 564.0 | 0.00e+00 | 95.3% |
| 189 | KR019064 | Aulacorthum solani clone A3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 563.0 | 0.00e+00 | 95.3% |
| 190 | DQ499044 | Myzus ornatus cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 563.0 | 0.00e+00 | 95.3% |
| 191 | GU978931 | Sitobion avenae isolate 050518S20 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 648 | 98.5% | 555.0 | 0.00e+00 | 95.2% |
| 192 | GU978925 | Delphiniobium hanla isolate 061014S01 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 648 | 98.5% | 555.0 | 0.00e+00 | 95.2% |
| 193 | KR044914 | Sitobion avenae voucher 10BBCHEM-0792 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 643 | 97.7% | 552.0 | 0.00e+00 | 95.2% |
| 194 | OR211575 | Sitobion avenae isolate Sa cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 644 | 97.9% | 551.0 | 0.00e+00 | 95.2% |
| 195 | MN320140 | Sitobion avenae voucher NIBGE APH-00646 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 564.0 | 0.00e+00 | 95.1% |
| 196 | MN320097 | Sitobion avenae voucher NIBGE APH-00645 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 563.0 | 0.00e+00 | 95.1% |
| 197 | EU701739 | Macrosiphum sp. C RGF-2008 voucher CNC#HEM012147 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 563.0 | 0.00e+00 | 95.1% |
| 198 | EU701527 | Aulacorthum solani voucher CNC#HEM113446 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 563.0 | 0.00e+00 | 95.1% |
| 199 | HQ970663 | Uroleucon russellae voucher CNC#HEM070170 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 200 | GU224128 | Myzodium mimulicola voucher CNC#HEM058063 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 201 | KF639705 | Uroleucon jaceae voucher INRA CBGP ACOE1018/chasses1018-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 202 | KF639716 | Uroleucon nigrocampanulae voucher INRA CBGP ACOE620/chasses620-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 203 | KF638729 | Amphorophora rubi voucher INRA CBGP ACOE1193/chasses1193-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 204 | HQ961729 | Macrosiphum valerianae voucher BIOUG| 658 |
100.0% |
562.0 |
0.00e+00 |
95.1% |
|
| 205 | KF639602 | Phorodon humuli voucher INRA CBGP ACOE386/chasses386-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 206 | EU701773 | Myzodium mimulicola voucher CNC#HEM113538 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 207 | KF639219 | Brachycaudus persicae voucher INRA CBGP ACOE1077/chasses1077-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 208 | KR039959 | Macrosiphum valerianae voucher BIOUG02022-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 209 | KR030930 | Uroleucon taraxaci voucher CNC#HEM071433 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 210 | JF883640 | Uroleucon taraxaci voucher CNC#HEM070385 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 211 | KF639520 | Megourella tribulis voucher INRA CBGP ACOE612/chasses612-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 212 | KF639339 | Delphiniobium sp. INRA CBGP ACOE2070/chasses2070-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 213 | HQ970710 | Uroleucon sp. RDBAB1092-10 voucher CNC#HEM006935 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 214 | MT127029 | Myzus persicae voucher NZMC_aphid 16439 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 215 | MT127006 | Myzus persicae voucher NZMC_aphid 13541 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 216 | KC502581 | Macrosiphum valerianae voucher CCDB-08110-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 217 | KY843443 | Hyperomyzus lactucae voucher BIOUG02533-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 218 | KF639720 | Uroleucon solidaginis voucher INRA CBGP ACOE454/chasses454-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 219 | GU668714 | Macrosiphum valerianae voucher CNC#HEM063727 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 220 | EU701693 | Hyperomyzus pallidus voucher CNC#HEM012103 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 221 | KR042847 | Macrosiphum woodsiae voucher CNC#HEM062497 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 222 | KR034126 | Uroleucon breviscriptum voucher CNC#HEM055942 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 223 | KR036808 | Illinoia paqueti voucher CNC#HEM057226 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 224 | HQ970866 | Illinoia rubicola voucher CNC#HEM070043 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 562.0 | 0.00e+00 | 95.1% |
| 225 | KF639441 | Hyperomyzus picridis voucher INRA CBGP ACOE1123/chasses1123-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 226 | GU668535 | Macrosiphum sp. RFBAE652-09 voucher CNC#HEM063634 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 227 | EU701953 | Uroleucon taraxaci voucher CNC#HEM039508 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 562.0 | 0.00e+00 | 95.1% |
| 228 | KR044059 | Uroleucon russellae voucher CNC#HEM057014 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 229 | KR041412 | Macrosiphum valerianae voucher CNC#HEM062501 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 230 | KR031114 | Uroleucon russellae voucher CNC#HEM056858 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 561.0 | 0.00e+00 | 95.1% |
| 231 | DQ499024 | Amphorophora rubi cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 561.0 | 0.00e+00 | 95.1% |
| 232 | EU071325 | Megoura nigra isolate 070518HJ21 cytochrome c oxidase subunit I (coi) gene, partial cds; mitochondrial | 657 | 99.8% | 561.0 | 0.00e+00 | 95.1% |
| 233 | EU071322 | Megoura litoralis isolate CZ264 cytochrome c oxidase subunit I (coi) gene, partial cds; mitochondrial | 657 | 99.8% | 561.0 | 0.00e+00 | 95.1% |
| 234 | KR031566 | Macrosiphum valerianae voucher 07PROBE-06673 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 561.0 | 0.00e+00 | 95.1% |
| 235 | DQ499031 | Brachycaudus persicae cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 561.0 | 0.00e+00 | 95.1% |
| 236 | OP164554 | Sitobion avenae isolate Aphid5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 561.0 | 0.00e+00 | 95.1% |
| 237 | KF639514 | Megoura viciae voucher INRA CBGP ACOE1091/chasses1091-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 561.0 | 0.00e+00 | 95.1% |
| 238 | OP174301 | Metopolophium dirhodum isolate AphidRose5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 561.0 | 0.00e+00 | 95.1% |
| 239 | JX507417 | Megoura viciae voucher A16 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 561.0 | 0.00e+00 | 95.1% |
| 240 | KR041094 | Uroleucon taraxaci voucher 10BBCHEM-0995 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 655 | 99.5% | 559.0 | 0.00e+00 | 95.1% |
| 241 | KR043726 | Macrosiphum valerianae voucher 07PROBE-06672 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 654 | 99.4% | 558.0 | 0.00e+00 | 95.1% |
| 242 | KY606280 | Aulacorthum solani isolate Jalandhar_A4 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 553.0 | 0.00e+00 | 95.1% |
| 243 | GU978920 | Aulacorthum muradachi isolate 030706S01 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 648 | 98.5% | 552.0 | 0.00e+00 | 95.1% |
| 244 | KR031932 | Macrosiphum valerianae voucher CNC#HEM057350 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 98.3% | 551.0 | 0.00e+00 | 95.1% |
| 245 | MT127008 | Myzus persicae voucher NZMC_aphid 13596 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 246 | KR563206 | Uroleucon sp. BOLD-2016 voucher BIOUG07800-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 247 | MT449692 | Macrosiphoniella formosartemisiae isolate Asteraceae-Ulleungdo cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 248 | EU701692 | Hyperomyzus lactucae voucher CNC#HEM006133 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 249 | MN320275 | Acyrthosiphon malvae voucher NIBGE APH-00448 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 250 | MT127064 | Myzus persicae voucher NZMC_aphid 21102 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 251 | MT127075 | Myzus persicae voucher NZMC_aphid 23996 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 252 | PV016927 | Uroleucon eupatoricolens isolate A103 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 253 | KP189472 | Hyperomyzus lactucae voucher ORP SP-LK155 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 254 | HQ578909 | Acyrthosiphon malvae voucher CNC#HEM049357 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 255 | KR033295 | Uroleucon erigeronensis voucher CNC#HEM061545 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 256 | FN868604 | Nasonovia ribis-nigri partial COI gene for cytochrome oxidase subunit 1 | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 257 | JF883537 | Macrosiphum valerianae voucher CNC#HEM070236 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 258 | MT127057 | Myzus persicae voucher NZMC_aphid 18712 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 259 | KR035043 | Metopolophium dirhodum voucher CHAN-2006-0443.2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 559.0 | 0.00e+00 | 95.0% |
| 260 | PV016928 | Uroleucon eupatoricolens isolate A120 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 261 | HQ578900 | Uroleucon eupatoricolens voucher CNC#HEM049327 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 262 | KR032194 | Uroleucon eupatoricolens voucher CNC#HEM056012 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 263 | HQ970679 | Uroleucon sp. RDBAB1058-10 voucher CNC#HEM070189 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 264 | OL597919 | Uroleucon sonchi isolate bseq2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 265 | KF639719 | Uroleucon rapunculoidis voucher INRA CBGP ACOE1500/chasses1500-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 266 | MN320268 | Acyrthosiphon malvae voucher NIBGE APH-00483 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 267 | GU978817 | Sappaphis piri isolate 040608J44 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 268 | ON929003 | Hyperomyzus lactucae cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 269 | MN320108 | Hyperomyzus lactucae voucher NIBGE APH-00732 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 270 | KY837406 | Hyperomyzus lactucae voucher BIOUG02439-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 271 | MT127025 | Myzus persicae voucher NZMC_aphid 15162 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 272 | KR035873 | Macrosiphum ptericolens voucher BIOUG02608-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 273 | MT127070 | Myzus persicae voucher NZMC_aphid 21680 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 274 | MN319864 | Acyrthosiphon malvae voucher NIBGE APH-00474 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 275 | KR035269 | Macrosiphum gaurae voucher CNC#HEM071420 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 276 | KR572605 | Macrosiphum sp. BOLD-2016 voucher 10BBCHEM-0260 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 277 | MW596769 | Hyperomyzus lactucae isolate FrChLoir08 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 278 | HQ971235 | Uroleucon breviscriptum voucher CNC#HEM064428 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 279 | HQ970686 | Macrosiphum sp. RDBAB1065-10 voucher CNC#HEM070222 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 280 | MT127069 | Myzus persicae voucher NZMC_aphid 21551 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 281 | MZ695840 | Uroleucon erigeronensis mitochondrion, complete genome | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 282 | MG163792 | Uroleucon (Uroleucon) sp. BIOUG00901-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 283 | GU224130 | Myzodium mimulicola voucher CNC#HEM064056 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 284 | HM416694 | Macrosiphum ptericolens voucher CNC#HEM064236 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 285 | GU224127 | Myzodium mimulicola voucher CNC#HEM061718 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 286 | KR573490 | Nearctaphis sp. BOLD-2016 voucher BIOUG03726-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 287 | KF639706 | Uroleucon jaceae voucher INRA CBGP ACOE1215/chasses1215-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 288 | MW292614 | Metopolophium dirhodum voucher Metopolophium2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 289 | GU668156 | Macrosiphum sp. RFBAE016-09 voucher CNC#HEM062561 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 290 | KF639335 | Corylobium avellanae voucher INRA CBGP ACOE762/chasses762-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 291 | PQ998256 | Sitobion calvulum voucher CS1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 292 | KF639732 | Uroleucon sonchi voucher INRA CBGP ACOE465/chasses465-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 293 | KR030764 | Uroleucon russellae voucher CNC#HEM062459 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 294 | KR044430 | Uroleucon russellae voucher CNC#HEM061413 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 295 | GU668115 | Uroleucon sp. RFBAE061-09 voucher CNC#HEM062606 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 296 | MW596772 | Uroleucon sonchi isolate HrKutin02 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 297 | KC502489 | Illinoia paqueti voucher CCDB-08110-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 298 | HE614034 | Phorodon humuli mitochondrial partial COI gene for cytochrome oxidase subunit 1 | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 299 | ON928996 | Metopolophium dirhodum cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 300 | KF639728 | Uroleucon sonchi voucher INRA CBGP ACOE1521/chasses1521-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 301 | KR571305 | Macrosiphum sp. BOLD-2016 voucher BIOUG07700-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 302 | MN320176 | Acyrthosiphon malvae voucher NIBGE APH-00479 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 303 | MN319844 | Acyrthosiphon malvae voucher NIBGE APH-00314 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 304 | MW804278 | Metopolophium dirhodum voucher VAITC7091 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 305 | FN868599 | Metopolophium dirhodum partial COI gene for cytochrome oxidase subunit 1, isolate 1 | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 306 | MF462148 | Megoura crassicauda isolate OAI376 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 307 | KR038503 | Sitobion avenae voucher 10BBCHEM-0586 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 308 | EU701754 | Micromyzus nr. katoi RGF-2008 voucher CNC#HEM054047 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 309 | KF639209 | Brachycaudus linariae voucher INRA CBGP ACOE2047/chasses2047-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 310 | KF639210 | Brachycaudus linariae voucher INRA CBGP ACOE2069/chasses2069-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 311 | EU071324 | Megoura nigra isolate 010511SH01 cytochrome c oxidase subunit I (coi) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 312 | EU071319 | Megoura crassicauda isolate 030513SH04 cytochrome c oxidase subunit I (coi) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 313 | MK547608 | Megoura crassicauda isolate OAI377 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 314 | MF462149 | Megoura crassicauda isolate OAI410 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 315 | EU071320 | Megoura crassicauda isolate 040508HJ05 cytochrome c oxidase subunit I (coi) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 316 | EU701946 | Uroleucon eupatoricolens voucher CNC#HEM012177 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 557.0 | 0.00e+00 | 95.0% |
| 317 | MK547612 | Megoura crassicauda isolate OAI756 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 557.0 | 0.00e+00 | 95.0% |
| 318 | OR287716 | Insecta sp. isolate SHARAWI_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 616 | 93.6% | 553.0 | 0.00e+00 | 95.0% |
| 319 | KR035706 | Hyperomyzus lactucae voucher CNC#HEM072081 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 653 | 99.2% | 554.0 | 0.00e+00 | 94.9% |
| 320 | KR031956 | Nasonovia ribisnigri voucher CNC#HEM071527 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 99.1% | 553.0 | 0.00e+00 | 94.9% |
| 321 | GU668343 | Acyrthosiphon assiniboinense voucher CNC#HEM063469 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 98.9% | 552.0 | 0.00e+00 | 94.9% |
| 322 | KR045188 | Sitobion avenae voucher CNC#HEM057149 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 98.8% | 551.0 | 0.00e+00 | 94.9% |
| 323 | MF154262 | Metopolophium dirhodum voucher Mdir_2013P23_TaestivumB cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 324 | MF154245 | Metopolophium dirhodum voucher Mdir_2013P17_TaestivumC cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 325 | MF154209 | Metopolophium dirhodum voucher Mdir_2013P3_TaestivumB cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 326 | MF154260 | Metopolophium dirhodum voucher Mdir_2013P22_TaestivumC cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 327 | MF154231 | Metopolophium dirhodum voucher Mdir_2013P11_TaestivumA cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 328 | MF154244 | Metopolophium dirhodum voucher Mdir_2013P17_TaestivumB cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 329 | MF154206 | Metopolophium dirhodum voucher Mdir_2013P2_TaestivumB cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 330 | MF154197 | Hyperomyzus lactucae voucher Hlac_2013P1_SoleracerusF cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 331 | MF154199 | Hyperomyzus lactucae voucher Hlac_2013P1_SoleracerusH cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 332 | MF154224 | Metopolophium dirhodum voucher Mdir_2013P8_TaestivumC cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 333 | MF154223 | Metopolophium dirhodum voucher Mdir_2013P8_TaestivumB cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 334 | MF154222 | Metopolophium dirhodum voucher Mdir_2013P8_TaestivumA cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 335 | MF154250 | Metopolophium dirhodum voucher Mdir_2013P19_TaestivumB cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 336 | MF154216 | Metopolophium dirhodum voucher Mdir_2013P6_TaestivumA cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 337 | MF154217 | Metopolophium dirhodum voucher Mdir_2013P6_TaestivumB cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 338 | MF154208 | Metopolophium dirhodum voucher Mdir_2013P3_TaestivumA cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 339 | MF154261 | Metopolophium dirhodum voucher Mdir_2013P23_TaestivumA cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 340 | MF154221 | Metopolophium dirhodum voucher Mdir_2013P7_TaestivumC cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 341 | MF154214 | Metopolophium dirhodum voucher Mdir_2013P5_TaestivumA cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 342 | MF154235 | Metopolophium dirhodum voucher Mdir_2013P12_TaestivumB cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 343 | MF154207 | Metopolophium dirhodum voucher Mdir_2013P2_TaestivumC cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 344 | MF154248 | Metopolophium dirhodum voucher Mdir_2013P18_TaestivumC cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 345 | GU978934 | Megoura crassicauda isolate 080522W08 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 346 | MF833276 | Aphidinae sp. BIOUG23514-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 347 | MF154205 | Metopolophium dirhodum voucher Mdir_2013P2_TaestivumA cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 348 | MF154243 | Metopolophium dirhodum voucher Mdir_2013P17_TaestivumA cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 549.0 | 0.00e+00 | 94.9% |
| 349 | KR044274 | Sitobion avenae voucher CNC#HEM057200 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 94.8% |
| 350 | EU701292 | Amphorophora rubicumberlandi voucher CNC#HEM032815 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 558.0 | 0.00e+00 | 94.8% |
| 351 | KR040666 | Sitobion avenae voucher CNC#HEM061441 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 557.0 | 0.00e+00 | 94.8% |
| 352 | MN320061 | Sitobion avenae voucher NIBGE APH-00574 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 557.0 | 0.00e+00 | 94.8% |
| 353 | KR038196 | Sitobion avenae voucher 10BBCHEM-0530 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 557.0 | 0.00e+00 | 94.8% |
| 354 | KR561705 | Macrosiphum zionense voucher 10BBCHEM-0589 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 355 | NC_063971 | Macrosiphum albifrons mitochondrion, complete genome | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 356 | MW582574 | Uroleucon sonchi isolate AQ08SO01_05_A cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 357 | KR038728 | Catamergus fulvae voucher CNC#HEM072441 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 358 | GU978778 | Amphicercidus japonicus isolate 030603J01 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 359 | MW582575 | Uroleucon sonchi isolate AQ11SO01_02 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 360 | KF639363 | Dysaphis lappae voucher INRA CBGP ACOE1353/chasses1353-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 361 | GU668612 | Acyrthosiphon sp. RFBAE925-09 voucher CNC#HEM061286 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 362 | MW740235 | Uroleucon caligatum isolate TH_U01 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 363 | GU668127 | Uroleucon sp. RFBAE049-09 voucher CNC#HEM062595 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 364 | KR031061 | Uroleucon caligatum voucher CNC#HEM051498 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 365 | KR563684 | Wahlgreniella sp. BOLD-2016 voucher BIOUG04343-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 366 | GU978956 | Macrosiphoniella sanborni isolate 080825J14 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 367 | HQ970708 | Uroleucon sp. RDBAB1090-10 voucher CNC#HEM006932 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 368 | PQ998255 | Sitobion calvulum voucher CS2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 369 | EU701636 | Dysaphis plantaginea voucher CNC#HEM028869 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 370 | KR038757 | Illinoia paqueti voucher BIOUG02055-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 371 | KR031740 | Sitobion avenae voucher 10BBCHEM-0577 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 556.0 | 0.00e+00 | 94.8% |
| 372 | EU701724 | Macrosiphum daphnidis voucher CNC#HEM054303 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 373 | MF040668 | Metopolophium dirhodum cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 374 | EU701944 | Uroleucon erigeronensis voucher CNC#HEM032914 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 375 | KP722575 | Myzus persicae voucher ZMIOZ24385 mitochondrion, partial genome | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 376 | KR030660 | Nearctaphis clydesmithi voucher BIOUG03026-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 377 | MN320242 | Uroleucon sonchi voucher NIBGE APH-00728 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 378 | EU701276 | Acyrthosiphon malvae voucher CNC#HEM011135 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 379 | KR040402 | Macrosiphum osmaroniae voucher 10BBCHEM-0930 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 380 | KR031610 | Nasonovia ribisnigri voucher CNC#HEM015392 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 381 | HQ971313 | Uroleucon erigeronensis voucher CNC#HEM068406 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 382 | KF639679 | Uroleucon aeneum voucher INRA CBGP ACOE1390/chasses1390-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 383 | GU668133 | Uroleucon caligatum voucher CNC#HEM062588 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 384 | KY837024 | Hyperomyzus lactucae voucher BIOUG02527-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 385 | EU701721 | Macrosiphum albifrons voucher CNC#HEM015401 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 386 | KR045209 | Uroleucon eupatorifoliae voucher CNC#HEM012178 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 387 | GU668281 | Uroleucon sonchi voucher CNC#HEM064085 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 388 | KR573304 | Rhopalosiphoninus sp. BOLD-2016 voucher BIOUG05931-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 389 | HQ443319 | Hyperomyzus carduellinus cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 390 | MW582573 | Uroleucon sonchi isolate AQ02SO05_02 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 391 | MW596771 | Uroleucon sonchi isolate FrLatte01 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 392 | MG163908 | Uroleucon (Uroleucon) sp. BIOUG00937-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 393 | GU668568 | Uroleucon erigeronensis voucher CNC#HEM063576 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 394 | KR033837 | Uroleucon sonchi voucher CNC#HEM062472 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 395 | KF639730 | Uroleucon sonchi voucher INRA CBGP ACOE1962/chasses1962-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 396 | KR033488 | Ceruraphis eriophori voucher CNC#HEM120020.2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 555.0 | 0.00e+00 | 94.8% |
| 397 | GU667430 | Ceruraphis eriophori voucher CNC#HEM063200 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 555.0 | 0.00e+00 | 94.8% |
| 398 | KR032001 | Uroleucon erigeronensis voucher CNC#HEM058105 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 555.0 | 0.00e+00 | 94.8% |
| 399 | DQ499039 | Metopolophium dirhodum isolate 1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 555.0 | 0.00e+00 | 94.8% |
| 400 | JF969256 | Ovatus crataegarius cytochrome oxidase subunit I gene, partial cds; mitochondrial | 657 | 99.8% | 555.0 | 0.00e+00 | 94.8% |
| 401 | KR044884 | Metopolophium dirhodum voucher CNC#HEM059938 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 555.0 | 0.00e+00 | 94.8% |
| 402 | DQ499034 | Nasonovia ribis-nigri cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 555.0 | 0.00e+00 | 94.8% |
| 403 | EU701947 | Uroleucon eupatorifoliae voucher CNC#HEM032022 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 555.0 | 0.00e+00 | 94.8% |
| 404 | JF883910 | Nasonovia aquilegiae voucher CNC#HEM071500 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 555.0 | 0.00e+00 | 94.8% |
| 405 | DQ499042 | Hyperomyzus lactucae isolate 1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 555.0 | 0.00e+00 | 94.8% |
| 406 | KR038652 | Nasonovia aquilegiae voucher CNC#HEM056837 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 554.0 | 0.00e+00 | 94.8% |
| 407 | ON929000 | Macrosiphum hellebori cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 654 | 99.4% | 552.0 | 0.00e+00 | 94.8% |
| 408 | KR043237 | Sitobion avenae voucher 10BBCHEM-0375 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 554.0 | 0.00e+00 | 94.7% |
| 409 | OR888813 | Macrosiphoniella sanborni isolate Chr1Wyd3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 410 | MN319985 | Uroleucon sonchi voucher NIBGE APH-00730 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 411 | KC502043 | Acyrthosiphon churchillense voucher CCDB-08110-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 412 | GU668718 | Amphorophora nr. geranii RFBAE785-09 voucher CNC#HEM063733 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 413 | GU224146 | Myzodium modestum voucher CNC#HEM114025 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 414 | EU701271 | Acyrthosiphon lactucae voucher CNC#HEM055937 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 415 | MF834728 | Utamphorophora sp. BIOUG22851-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 416 | GU978954 | Macrosiphoniella kuwayamai isolate 050616S13 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 417 | EU701289 | Amphorophora nr. geranii BOLD:AAC4602 voucher CNC#HEM028840 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 418 | EU701731 | Macrosiphum impatientis voucher CNC#HEM049306 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 419 | KF639366 | Dysaphis plantaginea voucher INRA CBGP ACOE1792/chasses1792-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 420 | MN319770 | Uroleucon sonchi voucher NIBGE APH-00729 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 421 | KF639717 | Uroleucon picridis voucher INRA CBGP ACOE1014/chasses1014-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 422 | EU701270 | Acyrthosiphon caraganae voucher CNC#HEM010261 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 423 | EU701907 | Sitobion avenae voucher CNC#HEM007722 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 424 | HQ578881 | Nearctaphis clydesmithi voucher CNC#HEM049266 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 425 | KC502042 | Acyrthosiphon churchillense voucher CCDB-08110-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 426 | GU668118 | Uroleucon sp. RFBAE060-09 voucher CNC#HEM062605 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 427 | GU978842 | Aulacorthum vandenboschi isolate 090507J36 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 428 | HQ971232 | Uroleucon sp. RFBAE1008-10 voucher CNC#HEM064436 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 429 | KF638720 | Acyrthosiphon caraganae voucher INRA CBGP ACOE1480/chasses1480-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 430 | KF639708 | Uroleucon jaceae voucher INRA CBGP ACOE1786/chasses1786-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 431 | HQ970671 | Uroleucon sp. RDBAB1050-10 voucher CNC#HEM070178 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 432 | KP189486 | Uroleucon sonchi voucher ORP SP-LK169 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 433 | NC_064371 | Acyrthosiphon caraganae mitochondrion, complete genome | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 434 | KF639455 | Macchiatiella rhamni voucher INRA CBGP ACOE828/chasses828-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 553.0 | 0.00e+00 | 94.7% |
| 435 | KC110893 | Aphididae gen. 1 sp. 1 DMT-2013 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 436 | HM405542 | Nasonovia ribisnigri voucher CGAEC-067 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 437 | KR576248 | Macrosiphum sp. BOLD-2016 voucher 10BBCHEM-0970 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 438 | MN320172 | Macrosiphoniella sanborni voucher NIBGE APH-00630 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 439 | EU701290 | Amphorophora nr. geranii BOLD:AAC4602 voucher CNC#HEM032928 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 440 | GU668437 | Uroleucon sonchellum voucher CNC#HEM049214 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 441 | KR044989 | Nasonovia ribisnigri voucher CNC#HEM007677 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 442 | KF639533 | Metopolophium dirhodum voucher INRA CBGP ACOE2415/chasses2415-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 443 | GU668140 | Uroleucon cirsii voucher CNC#HEM062578 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 552.0 | 0.00e+00 | 94.7% |
| 444 | EU701751 | Metopeurum fuscoviride voucher CNC#HEM054813 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 552.0 | 0.00e+00 | 94.7% |
| 445 | KR031437 | Uroleucon cirsii voucher CNC#HEM007912 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 552.0 | 0.00e+00 | 94.7% |
| 446 | KR037740 | Brachycaudus rumexicolens voucher CNC#HEM061781 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 552.0 | 0.00e+00 | 94.7% |
| 447 | JX507419 | Uroleucon cirsii voucher A3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 552.0 | 0.00e+00 | 94.7% |
| 448 | JF883644 | Ovatus crataegarius voucher CNC#HEM070389 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 552.0 | 0.00e+00 | 94.7% |
| 449 | DQ499037 | Macrosiphum hellebori isolate 1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 552.0 | 0.00e+00 | 94.7% |
| 450 | EU701629 | Corylobium avellanae voucher CNC#HEM054285 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 551.0 | 0.00e+00 | 94.7% |
| 451 | MH407714 | Sitobion avenae isolate SA362_F cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 656 | 99.7% | 551.0 | 0.00e+00 | 94.7% |
| 452 | KR040654 | Sitobion avenae voucher 10BBCHEM-0793 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 553.0 | 0.00e+00 | 94.5% |
| 453 | MN320188 | Sitobion avenae voucher NIBGE APH-00507 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 552.0 | 0.00e+00 | 94.5% |
| 454 | KR032054 | Nearctaphis kachena voucher CNC#HEM040036 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 455 | KR032146 | Abstrusomyzus phloxae voucher BIOUG05062-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 456 | KR032721 | Amphorophora forbesi voucher CNC#HEM113998 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 457 | KR034064 | Cryptomyzus ribis voucher CNC#HEM054299 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 458 | MT127071 | Myzus persicae voucher NZMC_aphid 22883 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 459 | KR561902 | Aphthargelia sp. BOLD-2016 voucher 10BBCHEM-0218 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 460 | MF101667 | Sitobion avenae cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 461 | KF639471 | Macrosiphum cholodkovskyi voucher INRA CBGP ACOE410/chasses410-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 462 | GU668542 | Cryptomyzus ribis voucher CNC#HEM063621 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 463 | KR578985 | Hyperomyzus sp. BOLD-2016 voucher BIOUG05821-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 464 | KF639362 | Dysaphis foeniculus voucher INRA CBGP ACOE1951/chasses1951-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 465 | KR035956 | Macrosiphum pseudocoryli voucher CNC#HEM061335 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 466 | KF639445 | Hyperomyzus rhinanthi voucher INRA CBGP ACOE2603/chasses2603-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 467 | KR040388 | Sitobion avenae voucher CNC#HEM056933 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 468 | JX507424 | Macrosiphum funestum voucher A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 469 | KR564367 | Wahlgreniella sp. BOLD-2016 voucher BIOUG04448-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 470 | HQ632649 | Uroleucon sonchi voucher IIHR-BT-19 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 471 | GU668623 | Amphorophora sensoriata voucher CNC#HEM061266 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 472 | GU668134 | Amphorophora rubicumberlandi voucher CNC#HEM062589 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 473 | MN319782 | Sitobion avenae voucher NIBGE APH-00332 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 474 | KF639193 | Brachycaudus helichrysi voucher INRA CBGP ACOE705/chasses705-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 475 | EU701774 | Myzodium modestum voucher CNC#HEM113216 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 476 | KF639375 | Dysaphis reaumuri voucher INRA CBGP ACOE1461/chasses1461-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 477 | KF638743 | Anuraphis subterranea voucher INRA CBGP ACOE2053/chasses2053-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 478 | KF639474 | Macrosiphum euphorbiae voucher INRA CBGP ACOE1129/chasses1129-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 479 | MN319951 | Sitobion avenae voucher NIBGE APH-00505 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 480 | KR581782 | Macrosiphum sp. BOLD-2016 voucher 10BBCHEM-0587 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 481 | MF837207 | Aphidinae sp. BIOUG27106-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 482 | KY832655 | Sitobion avenae voucher BIOUG02439-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 483 | KF639334 | Corylobium avellanae voucher INRA CBGP ACOE2015/chasses2015-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 484 | KR035528 | Amphorophora sensoriata voucher CNC#HEM055774 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 485 | NC_024683 | Sitobion avenae mitochondrion, complete genome | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 486 | KF639368 | Dysaphis plantaginea voucher INRA CBGP ACOE2472/chasses2472-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 487 | KR042677 | Sitobion avenae voucher CNC#HEM056932 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 488 | JF883610 | Macrosiphum stanleyi voucher CNC#HEM070338 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 489 | KF639473 | Macrosiphum euphorbiae voucher INRA CBGP ACOE1080/chasses1080-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 490 | KC502045 | Acyrthosiphon churchillense voucher CCDB-08110-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 491 | GU667451 | Macrosiphum pseudocoryli voucher CNC#HEM063177 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 492 | KR032757 | Macrosiphum stanleyi voucher CNC#HEM057555 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 493 | KF639161 | Brachycaudus helichrysi voucher INRA CBGP ACOE1937/chasses1937-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 494 | MF830233 | Aphidinae sp. BIOUG20255-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 495 | KR562174 | Aphidinae sp. BOLD-2016 voucher BIOUG07900-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 549.0 | 0.00e+00 | 94.5% |
| 496 | GU978800 | Hydronaphis impatiens isolate 040917J01 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 657 | 99.8% | 549.0 | 0.00e+00 | 94.5% |
| 497 | EU701753 | Micromyzus nr. katoi RGF-2008 voucher CNC#HEM113445 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 549.0 | 0.00e+00 | 94.5% |
| 498 | KX054740 | Sitobion avenae voucher sc_02284 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 552.0 | 0.00e+00 | 94.4% |
| 499 | MN320205 | Sitobion avenae voucher NIBGE APH-00037 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 552.0 | 0.00e+00 | 94.4% |
| 500 | KR031584 | Sitobion avenae voucher CNC#HEM055855 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 551.0 | 0.00e+00 | 94.4% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the identity (%) of BLAST hits grouped by genus. Each data point shows the alignment identity between the query and matched reference sequence. The analyst may wish to use this to make a subjective genus-level identification for the sample.
This sections shows the taxa of interest specified by the submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity |
|---|---|---|---|---|---|
| Aphidius ervi | - | - | - | - | - |
| Aphididae | family | Aphididae | Wahlgreniella nervata | KF285590 | 1.0 |
See the Database coverage section to see database coverage for taxa of interest.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
The target taxa include candidate species, the preliminary morphology ID, and any taxa of interest provided by the submitter. Each of these taxa are independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of the target taxon. Insufficient coverage of a taxon can result in that taxon not be correctly identified as the taxonomic identity of the sample. For example, if the sample is Homo sapiens, but Homo sapiens sequences are not included in the reference database, the analysis will be unable to identity Homo sapiens as the correct taxonomic identity, and will most likely assign the closest relative with reference data as the taxonomic identity.
Preliminary ID
Taxa of interest
Database coverage
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
There are NA sequences in the reference database for Aphididae at the given locus COI.
Database coverage
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 346 sequences in the reference database for Aphidius ervi at the given locus COI.
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3A:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Database coverage
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
There are NA sequences in the reference database for Aphididae at the given locus COI.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |